Cyanidioschyzon merolae Genome Project v3

Home / Introduction / Browser / BLAST / Publications / Download / Member
annot#6745
LocusCMW024R [Show EST mapping]
LocationMTDNA 12978<13050 [Show ORF map]
AnnotationtRNA Ile (GAU)
CommentsGENE{trnI} RNA{tRNA}
Sequencegagtctatagctcaacggttagagcgcacgcctgataagcgtgagggtggttgttcaagt
caacttagactca

(73 aa)
Reference: Matsuzaki, M. et al. Nature 428, 653-657 (2004)
Nozaki, H. et al. BMC Biology 5, 28 (2007)
Last modified: 2019-12-26 17:05:39 JST