Cyanidioschyzon merolae Genome Project v3

Home / Introduction / Browser / BLAST / Publications / Download / Member
annot#6748
Locus
LocationMTDNA 15501<16268 [Show ORF map]
AnnotationATP synthase A chain (protein 6)
CommentsGENE{atp6} EC{3.6.1.34} GI{4115788}
Sequenceatgagtttattaagtaaaagaattatattaagtcctttagaacaattcgaatttacaact
ttaattcctttaaatatttataagtataatttatcaatcacaaatgctacactattttta
ttgattattttaattacatttttgtttattgctttattttcattgaaaggaaagctctta
gtgcccaatagatggcagttagttatagaaataacttatgattttgtcataataataatt
ttagataacctgggtcataagggagaaagatatttccctataatttttacaatttttaca
atattattaatgtgtaatttattaggattaattccttatagttttactgttactagtcac
atctgttttacttttggattagcgtttgcgatctttattggaattaatattattggcatt
agggaacatggttttcatttctttgccatttttttaccaaaaggcgcgcctttagcaatt
cttcctttattagttttaattgaatttgtatcttacattgtaaaagttttcacattagct
attcgattatttgcaaatataacatctgggcatactttattaaaaattattgctggattt
gcttggacattgttaactttgggtggatttctttcactattacatatatttccattgtta
attttattcgtactaattggtttagaaatgggaattgcttttttacaagcttatgttttt
gcattattagtttgtatttatctaaacgacgtaatagagtttcattaa

(768 aa)
Reference: Matsuzaki, M. et al. Nature 428, 653-657 (2004)
Nozaki, H. et al. BMC Biology 5, 28 (2007)
Last modified: 2019-12-26 17:05:39 JST