Cyanidioschyzon merolae Genome Project v3

Home / Introduction / Browser / BLAST / Publications / Download / Member
annot#6749
Locus
LocationMTDNA 16296<18158 [Show ORF map]
Annotationcytochrome c-type biogenesis protein ccmF
CommentsGENE{ccmF} GI{4115789}
Sequenceatgtttggttacgtattgcattttttattaatttttatctttatttattcatgtaacttt
ttttttttagattcattttacaaatacaagaaagttactaccctattagaaatagtacat
cattattatttttattttaattacatatacaatattattattatcattatttggttaatt
ggtataatattactattgtcggatttttctatattgtttgtggtggaattatcttctgta
aaccaaccaagtctttataaattaataactttatggtccaataatgaaggatcattattc
ttaggatatttcttgcaattcattatttattttacttttatcaattattttattaacaaa
ttaacactgattgttaaactaacttttttttataatgtctattttattctatttaatata
agttttctaagtctaacattattgctaatatttttgcgctttgatttttttttcaatttc
actgttttggaaggtaatgaactaaattttttattacaagatataaatatattaattcat
ccaccattaatatatataagttatgcttcgtactctattattttttctatttcttttacc
attttaataataaaatgtaaattttatgtgctttatattttaagatttttaaatctaatt
ggttggtttattgcatcttttagtattttattaggaagtagatgggcttatacagaatta
ggttggggtggtttctggttttgggattccgtagagattatttctctattaccatggtta
ttaagccttgctttattacatagtttgttgctaaacttgaagttttgcattatccgttta
gattctttatttctgggaatggctatctattttgttattattattggaataattctagtt
cgttccggtttgctgcaatcagtacatacttttgtcaattcgccaaattttttaataatt
ttcttgtatttctttttggtattcatttttattctaatagttatacttttaaagaaatat
acttattttactagtatttttgacttaaataatcattataattttgtttattatatattt
ttattagtaattttatatttcttatacttattatttgttttatatttcccttttttaatt
aaatgttataatgataatgcgttattatttagtttcggttttttcaataaaatattatta
ttatttataggaattttattaacattaataattatatttttaataaattcttggaaatta
atttttatttttctaggcattatcataataggcggaattaggggatttcctgaaattttt
ttagccttatatttttttatttatttattgttatttactctaattttaattataaaacaa
aaattttcctttattgtttatcattttaacttttttttcataatgttaagtttattatta
ataacaatttatggagaagaatttattttaaatttttctattggtaaaacattgctatta
aatgataattttatcataatttttcgtgatttaaatcacatatggtcgactaattattta
tccacttacggaaacttcttaattacagattttcataatcctatgtgttatgaaaacatt
cagaacgtattattttctgaaaaacgtttttatttatatcaaagtttaataaatacaaaa
tcaattatttacacgaatttaatgagtgatgtatacatcttattgggtgatggaaatttt
gaaaatggttggtatagtagaattttatttatgccatttatatcctggttttggttaggt
ggaatattcttattagacagtattattttttctttatttcggtgtataaaaaattttcaa
taa

(1863 aa)
Reference: Matsuzaki, M. et al. Nature 428, 653-657 (2004)
Nozaki, H. et al. BMC Biology 5, 28 (2007)
Last modified: 2019-12-26 17:05:39 JST