Cyanidioschyzon merolae Genome Project v3

Home / Introduction / Browser / BLAST / Publications / Download / Member
annot#6759
Locus
LocationMTDNA 21745<22191 [Show ORF map]
Annotation50S ribosomal protein L16
CommentsGENE{rpl16} GI{4115798}
Sequenceatgtcagttaataaacgaactttcaaaaagaattttttgccttctcttaaaaagaaggca
aaaaattcttttattgaaaattatggaaacttttctttaaaagcaacagaatcaggttac
attactgcttcacaactggaaactgtcaaacgtataagcataaaatttttaaaagatcat
ggttcaaaccaactaagaatgggtaaacaaaacatagtttggttacgtgttcatcctaca
ttttttgttacatcaaaaggttcagaagtaagaataggtggtggtaaaggatctttaaaa
acgcgagttgctaaaattgattcaggacaaattatcttagaatttaatttggaatctatt
actattgctagaaaattgcttaaattaatttcaattcgtttacctattaaaattgtttta
aattctaatatcaatttagaatcttaa

(447 aa)
Reference: Matsuzaki, M. et al. Nature 428, 653-657 (2004)
Nozaki, H. et al. BMC Biology 5, 28 (2007)
Last modified: 2019-12-26 17:05:39 JST