Cyanidioschyzon merolae Genome Project v3

Home / Introduction / Browser / BLAST / Publications / Download / Member
annot#6761
LocusCMW040R [Show EST mapping]
LocationMTDNA 23178<23248 [Show ORF map]
AnnotationtRNA Gln (UUG)
CommentsGENE{trnQ} RNA{tRNA}
Sequencetgggatatagccaagaggtaaggcagtagtttttgacactaagaccaaaggttcgaatcc
ttttatcccag

(71 aa)
Reference: Matsuzaki, M. et al. Nature 428, 653-657 (2004)
Nozaki, H. et al. BMC Biology 5, 28 (2007)
Last modified: 2019-12-26 17:05:39 JST