Cyanidioschyzon merolae Genome Project v3

Home / Introduction / Browser / BLAST / Publications / Download / Member
annot#6763
LocusCMW042R [Show EST mapping]
LocationMTDNA 23351<23438 [Show ORF map]
AnnotationtRNA Ser (UGA)
CommentsGENE{trnS} RNA{tRNA}
Sequenceggatgaatggctgagcggtttaaagcactagtcttgaaaactagcgtatttcaataagat
accgtgggttcgaatcccacttcatcct

(88 aa)
Reference: Matsuzaki, M. et al. Nature 428, 653-657 (2004)
Nozaki, H. et al. BMC Biology 5, 28 (2007)
Last modified: 2019-12-26 17:05:39 JST