Cyanidioschyzon merolae Genome Project v3

Home / Introduction / Browser / BLAST / Publications / Download / Member
CPDNA     68689  CTTTCAAGATTTCAATGGTTTCATCTACGGTGGGTTCTCCTACCATGACAGGTTGGAATC  68748
sz45b10   638    ............................................................  579

CPDNA     68749  GGCGTTCTAATGCTGCATCCTTTTCTATATGTTTTCTATATTCTTCTAATGTGGTGGCAC  68808
sz45b10   578    ............................................................  519

CPDNA     68809  CAATACATTGTAATTCACCTCTTGCTAAGGCAGGTTTTAAGATATTGGCAGCATCAATGG  68868
sz45b10   518    ............................................................  459

CPDNA     68869  CACCTTCTGCAGCACCAGCACCAATAAGTGTATGTACTTCATCAATAACTAAAATGACAT  68928
sz45b10   458    ............................................................  399

CPDNA     68929  TGCCCACTTCACGGATTTCATCCATGACTTTTTTCAATCTTTCTTCAAATTCCCCTCTAT  68988
sz45b10   398    ............................................................  339

CPDNA     68989  ATTTGGTTCCTGCTACTAGAAGACCTATGTCTAAGGTGATGACTTTCATGTCTTCTAAGA  69048
sz45b10   338    ............................................................  279

CPDNA     69049  TGTCTGGTATATCTCGGTCCGCAATTCTTTGTGCTAAACCTTCAGCAATAGCAGTTTTTC  69108
sz45b10   278    ............................................................  219

CPDNA     69109  CTACACCAGGTTCACCTATTAACACAGGATTGTTTTTGGTACGGCGTCCTAAAATTTGGA  69168
sz45b10   218    ............................................................  159

CPDNA     69169  TCACACGTTCTATTTCTTTTTCTCTACCTACCACAGGATCTAGTTCTCCTTCCATGGCAA  69228
sz45b10   158    ............................................................  99

CPDNA     69229  GTTCTGTTAAATTCACACCAAATTCTTCTAAGGTAGGAGTTCTGCTACGTGAGTAACCAC  69288
sz45b10   98     ............................................................  39

CPDNA     69289  CACCAATGACTACCTCAGAAGTTTCATCAAGCATACGC  69326
sz45b10   38     ......................................  1


Reference: Matsuzaki, M. et al. Nature 428, 653-657 (2004)
Nozaki, H. et al. BMC Biology 5, 28 (2007)
Last modified: 2019-12-26 17:05:39 JST