Cyanidioschyzon merolae Genome Project v3

Home / Introduction / Browser / BLAST / Publications / Download / Member
CPDNA     13536  TACAGCCCCATGTTACAGCCCCATGTTAGAGCCCTCCGTCATGGCATATCACTTATGGCC  13595
rsz88e19  54     ............................................................  113
sz66j14   388              ..................................................  339

CPDNA     13596  GATTGCCACATTTGTTGAATGCGCTCTCCTGAATCCATTGTTGATAAAGGATCTTTTCTT  13655
rsz88e19  114    ............................................................  173
sz79j17   621                                                    ............  610
sz66j14   338    ............................................................  279

CPDNA     13656  AATCTATGACGTAAACTCATAACAATCACTTTTTCAATATCTTGAATTTCTACTTGCTTA  13715
rsz88e19  174    ............................................................  233
sz79j17   609    ............................................................  550
sz66j14   278    ............................................................  219

CPDNA     13716  CAATTTCTTAAGGCGGCGTGAGCACAAGCAGCTCTATTGGTGACAATATCACCACGTAAA  13775
rsz88e19  234    ............................................................  293
sz79j17   549    ............................................................  490
sz66j14   218    ............................................................  159

CPDNA     13776  CCATCTATATCTAATTCCGCACAAATTTGTGATATCAAAACTTTATAAGATTCACTTATT  13835
rsz88e19  294    ............................................................  353
sz79j17   489    ............................................................  430
sz66j14   158    ............................................................  99

CPDNA     13836  GTTACATGAGGTAAGAGCTGTTGTGCGTGAACAATTTGGTTAGATAATTTTT-CTTGAGC  13894
rsz88e19  354    ....................................................-.......  412
sz79j17   429    ....................................................-.......  371
sz66j14   98     ....................................................A.......  39

CPDNA     13895  TTCCTGCCAACGTTGTAAATATTTTTCGGGATCACGGTCAAAAGCACTTCTCTCTTCTAC  13954
rsz88e19  413    ............................................................  472
sz79j17   370    ............................................................  311
sz88e19   508                                                             ...  506
sz66j14   38     .....................                                         18

CPDNA     13955  AATTTTGACGCGTAATTTAGCATCTTTAACTGTGGAAATCGATGTATGCAAACCAAAGCG  14014
rsz88e19  473    ............................................................  532
sz79j17   310    ............................................................  251
sz88e19   505    ............................................................  446

CPDNA     14015  ATCAAGTAATTGTGGTCTTAATTCTCCTTCTTCAGGATTTCCTGAACCTATAAGCACAAA  14074
rsz88e19  533    ............................................................  592
sz79j17   250    ............................................................  191
sz88e19   445    .............................N.........................N....  386

CPDNA     14075  GCGTGCCGGATGACGTATAGAAATTCCTTCTCTCTCCACTGTGTTCCATCCTGATGCTGC  14134
rsz88e19  593    ............................................................  652
sz79j17   190    ............................................................  131
sz88e19   385    ............................................................  326

CPDNA     14135  CGCATCTAACAAAATATCTACTAAATGATCATCTAATAAATTTACTTCATCTACATATAA  14194
rsz88e19  653    ............................................................  712
sz79j17   130    ............................................................  71
sz88e19   325    .....N..........................N...........................  266

CPDNA     14195  TAACCCACGATGTGCTTTAGCTAATAAACCTGGTTCGAAAGATTTGACACCTTCTACTAA  14254
rsz88e19  713    ..N................                                           731
sz79j17   70     ............................................................  11
sz88e19   265    ......N..............................................N......  206

CPDNA     14255  AGCTTTTTCCATATCTATAGTACCACATAATCTATCTTCTGTAGCACCTAAGGGCAAATC  14314
sz79j17   10     ........                                                      3
sz88e19   205    ............................................................  146

CPDNA     14315  AACCATGGGTACCTTTATATATTCAATAACTAAGGGTTCCTGATTAGCTAtttttttttG  14374
sz88e19   145    ............................................................  86

CPDNA     14375  TACATCTGTGCTCATCAGTTCTGGATCCGAAGGATGAGAGTTAAATAAGTCGCCTTTCAC  14434
sz88e19   85     ............................................................  26

CPDNA     14435  TACTGGTATCGAAGGTAAGATATCA  14459
sz88e19   25     .........................  1


Reference: Matsuzaki, M. et al. Nature 428, 653-657 (2004)
Nozaki, H. et al. BMC Biology 5, 28 (2007)
Last modified: 2019-12-26 17:05:39 JST