Cyanidioschyzon merolae Genome Project v3

Home / Introduction / Browser / BLAST / Publications / Download / Member
CPDNA     10977  GGCAAATAAGCCCGCAATTCGAGTTAAAACGCCTGCCTCATCTTCTACTAATACAGATAA  11036
rsz74f23  1      ..............NNN.....................N.....N...............  60

CPDNA     11037  AGTATGTTTCATGATGCCTGCTTCATACACAAGCACAAAACAAAAAATAGCCCTGCCACG  11096
rsz74f23  61     ............................................................  120

CPDNA     11097  GGCATCCAACCTGCCATAAGAGCAGACATTTGGCTACTTTCTGCTAGTGCCTCACAACCA  11156
rsz74f23  121    ............................................................  180

CPDNA     11157  AATCCGAATAAATAATAGCCAAATAAAACTATTAAACTCAAGATGAATCCCTTTTTGCTA  11216
rsz74f23  181    ............................................................  240

CPDNA     11217  ACACTTGCTAAGCTACTACCTATCAAATGCAACAAACCACAACTTATCGGAAAGGCATAT  11276
rsz74f23  241    ............................................................  300

CPDNA     11277  TTTTGATAATAGCGAATGGCTATATGTTTGTTAAACTCAGCTACTTGTTTATAACATTTT  11336
rsz74f23  301    ............................................................  360

CPDNA     11337  AATGTTTGTACATTCATCCACATAGGTTGCCATTGTTGTTGACTTATCCAGGCTGTTGGC  11396
rsz74f23  361    ............................................................  420

CPDNA     11397  CATTCCATTTTCGCTACATGACTTTGCAATTGTAGTTGAAATTGATCATCCCATTGATAA  11456
rsz74f23  421    ............................................................  480

CPDNA     11457  TGTACTACTTGTTTAGCTATCCAACGTGCCCCATCCCAATCAATTTGTTTCGCCATCCAT  11516
rsz74f23  481    ............................................................  540

CPDNA     11517  AATTGATTCATTTCACTATCCCACATGACACAATGATTCATATGTAATGGTTTCCACTCT  11576
rsz74f23  541    ............................................................  600

CPDNA     11577  TTCACATAAATAAGTTTATGATTGATTTGATTTACTAAGGCCTTTGATGTTATTTGGTTT  11636
rsz74f23  601    ............................................................  660

CPDNA     11637  TGGATTTGATCTTGCAACTTATGTAACGAATAATTAGCCAAAGGTAAAGCCCACTCATTC  11696
rsz74f23  661    .............................                                 689

CPDNA     11697  CATTGCCAAGCTAACCATCCTACCATACATCCAAAAATTAAAGAAGGTTTTAACCAACGA  11756

CPDNA     11757  GCTACACCTATACCACTTGTTCTTAAGGCCATCAAGTCTAAATTGGCATAAGCAAAGATA  11816

CPDNA     11817  CCTCCAAAAACACAACTGGCCGGTAAACCTAAGTGAATACTAAGTACTAATTGTAAACAT  11876

CPDNA     11877  AAGATTTGACAAGCCATATCCAAACTTAAACCTTGGGTAATTTGACGCATGACATCCACT  11936

CPDNA     11937  AAAGCACCTGCAGAAAAAGTTAAAGCTAAACAAGCGGATAAAGCATAAAGAAAAGGAGTC  11996

CPDNA     11997  CAAAGATGACTCCAAATATATTGTTCAAAAATGGTCATAAAAGAATGATTGACCTAACCT  12056

CPDNA     12057  AAATAAGTCTGCTTCACAAGCGAATTTGTCCATAACTGTGTTGAATTTCCTTTAGCTAAT  12116
sz74f23   633                                                             ...  631

CPDNA     12117  ATATGTCCTTCAAATAACACATATGCTCTATCCACAATTTGTAACGTCTCTTTTGCATGA  12176
sz74f23   630    ............................................................  571

CPDNA     12177  TGGTCTGTGATCATTACACCAATTTTCCATTCTTTCAGTCTTTTGATTGTATTTTGTAAA  12236
sz74f23   570    ............................................................  511

CPDNA     12237  AGTTTCAGAGATTTGGGATCAACTGCTGCAAAAGGTTCATCTAATAATAAAAACTTAGCT  12296
sz74f23   510    ............................................................  451

CPDNA     12297  TGTTGTGATACAGCTTTGGCCAATTCGACTCGTTTGCGTTCACCACCAGATAAATGGCTG  12356
sz74f23   450    ............................................................  391

CPDNA     12357  CATACTTGTTGGGAGAGTGATTGTAAATCAAATAAAGATAAAACATGCGCACTTAAATTT  12416
sz74f23   390    ............................................................  331

CPDNA     12417  TGCGCCACGGTTAGCGAAGAAAACAAACTTGATTGTTGTGGTAAATAAATTAATCCTAAT  12476
sz74f23   330    ............................................................  271

CPDNA     12477  TGTGCACGTTCATCTACATGCATATGACTTAAGAATTGTTGGCCCATCCAAATTTCACCT  12536
sz74f23   270    ............................................................  211

CPDNA     12537  TGGGTAACCTTTGTCACACCTGCTATGATGTTAAATAACGTTGTTTTACCAGCACCATTG  12596
sz74f23   210    ............................................................  151

CPDNA     12597  ACACCCAATAAGGCCACAATTTCTCCTTGTTTGACACTAACTGTTATTCCTTTTAGTACA  12656
sz74f23   150    ............................................................  91

CPDNA     12657  CAATGATTACCATAATCATGTGAAATTTGAGAAGCAATCAATCTCATGAtttttttGGTA  12716
sz74f23   90     ............................................................  31

CPDNA     12717  CAAAAATAGCACTTAAATTTCTGCCTTCTT  12746
sz74f23   30     ..............................  1


Reference: Matsuzaki, M. et al. Nature 428, 653-657 (2004)
Nozaki, H. et al. BMC Biology 5, 28 (2007)
Last modified: 2019-12-26 17:05:39 JST